Part:BBa_K4652001

SpyTag (D7A)-GFP-SpyCatcher

SpyRing cyclization technique to enhance enzyme thermal resilience was clarified by Dr. Mark Howarth’s team¹. SpyRing harbors genetically modified SpyTag (13 amino acids) on the N-terminus and SpyCatcher (12kDa) on the C-terminus on the protein of interest. This context spontaneously reacts together through an irreversible isopeptide bond. SpyRing cyclization was demonstrated successfully to increase stress resilience of β-lactamase and some industrially important enzymes.

Linear Form of SpyTag-GFP-SpyCatcher Mutant

Mechanism

The mechanism for the spontaneous cyclization reaction involves Asp7 on the SpyTag at the N-terminus forming double hydrogen bonds with Glu77 on the SpyCatcher at the C-terminus. This interaction strengthens the creation of an irreversible isopeptide bond between Asp7 on SpyTag and Lys31 on SpyCatcher. As a result, the protein is seamlessly cyclized, enhancing its resistance to chemical, thermal, or enzymatic degradation³.

Plasmid construction

To investigate the impact of cyclization on protein thermostability, we created a linear version of SpyTag-GFP-SpyCatcher by introducing a mutation, substituting Asp7 with Ala7 on SpyTag, using site-directed mutagenesis by high-fidelity KOD-plus DNA polymerase with a primer sequence of 5'- AGCCCACATCGTGATGGTGGCAGCCTACAAGCCGACGAAG -3’. The mutated site was confirmed by DNA sequencing. This mutant (SpyTag (D7A)-GFP-SpyCatcher, Part:BBa_K4652001) was constructed in the same format, resulting in the expression plasmid of T7-RBS-SpyTag (D7A)-GFP-SpyCatcher-Tr (Part:BBa_K4652003).

Comparison between linear and circular form of GFP proteins

Figure 7 clearly demonstrates that the linear version fails to withstand temperatures of 90°C beyond 1 minute, even though it maintained high activity up to 0.5 minutes. Meanwhile, the cyclized GFP exhibited fluorescence intensities of around 20-30%, when exposed to 90°C or even under boiling conditions (100°C) for as long as 3 minutes. These outcomes underscore the enhanced thermal tolerance conferred by protein cyclization.

Figure 7. Thermal tolerance between cyclized and linear forms of SpyTag-GFPmut3b-SpyCatcher proteins. E. coli BL21 were transformed with BBa_K4652002 for the cyclized form and BBa_K4652003 for the linear form. After induced by 0.3 mM IPTG at 25°C for 20 hrs, the bacterial lysates were harvested and subjected to 90°C or 100°C treatment for up to 3 min at the intervals of 0.5 min. The fluorescence of 100μl from each treated lysate was measured at Ex/Em = 483/513 nm. All values were normalized to the average of the untreated control, with the resulting ratio representing the fluorescence fold change.

Protein structure of SpyTag-GFP-SpyCatcher

To validate the protein structures resulting from SpyTag and SpyCatcher cyclization and its linear counterpart generated through mutation, we conducted SDS-PAGE followed by Coomassie Blue Staining on IPTG-induced bacterial lysates. In Figure 8, the linear mutant manifested at its anticipated size of 44.22 kDa. The mobility of the cyclized protein differed, likely due to changes in charge or conformation. This observation aligns with Dr. Schoene's findings¹ and supports the results from our heat tolerance fluorescence experiments. Notably, our protein analysis can partly account for the diminished activity observed during high-temperature exposure in Figure 7, possibly attributable to incomplete GFP cyclization. When GFP continues exposure at near boiling temperatures, the cyclized form exhibits marked resistance over an extended duration.










Figure 8. Protein structure analysis of cyclized form and linear form of SpyTag-eGFP-SpyCatcher. IPTG-induced lysates were run on a 4-12% gradient SDS-PAGE (BIO-RAD) and stained with standard Coomassie Blue. The AceColor Prestained Protein Marker (10 - 180 kDa) was used for size reference. Lane 1 refers to the cyclized proteins derived from lysates of SpyTag-GFP-SpyCatcher (BBa_K4652002). Lane 2 refers to the linear proteins derived from lysates of SpyTag (D7A)-GFP-SpyCatcher (BBa_K4652003). The predicted molecular weight for the SpyTag-GFP-SpyCatcher protein is 44.22 kDa.

REFERENCE

1. Schoene C, Bennett SP, Howarth M. SpyRings Declassified: A Blueprint for Using Isopeptide-Mediated Cyclization to Enhance Enzyme Thermal Resilience. Methods Enzymol. 2016;580:149-67. doi: 10.1016/bs.mie.2016.05.004. Epub 2016 Jun 16. PMID: 27586332.
2. Schoene C, Fierer JO, Bennett SP, Howarth M. SpyTag/SpyCatcher cyclization confers resilience to boiling on a mesophilic enzyme. Angew Chem Int Ed Engl. 2014 Jun 10;53(24):6101-4. doi: 10.1002/anie.201402519. Epub 2014 May 9. PMID: 24817566; PMCID: PMC4286826.
3. Reddington SC, Howarth M. Secrets of a covalent interaction for biomaterials and biotechnology: SpyTag and SpyCatcher. Curr Opin Chem Biol. 2015 Dec;29:94-9. doi: 10.1016/j.cbpa.2015.10.002. Epub 2015 Oct 30. PMID: 26517567.

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  INCOMPATIBLE WITH RFC[1000]

  Illegal BsaI.rc site found at 701